Loading...

Table of Content

20 June 2012, Volume 39 Issue 6
The Future Strategic Direction of Dairy Industry is to Develop Quality Milk
WANG Jia-qi
2012, 39(6):  1-5. 
Abstract ( 436 )  
References | Related Articles | Metrics
Strategic direction decides the rise and fall of dairy industry. China dairy industry has developed rapidly for 30 years and achieved tremendous progress on milk quantity production. But after 2008,the industry has been facing to decide the new strategic direction for future development. It is "A glass of quality milk the revitalization of a nation". Our national research team has established Chinese quality milk producing technology system through nearly 20 years hard exploration. The results showed that with the application of this technology system,protein feed efficiency was improved by 8% to15%,milk fat and protein contents were above 3.5% and 3.1%,respectively,SSC was less than 400000 /mL and TBC was less than 100000 CFU/mL,all of which meet the international quality milk standard. Quality milk development needs national policy support for technology extension and dairy cultural building in the future.
Main Risk Factor Analysis for Milk Quality and Safety Ⅵ.Contaminants
ZHEN Yun-peng, WANG Jia-qi, ZHENG Nan, HAN Rong-wei, XU Xiao-min, QU Xue-yin, ZHAO Lian-sheng
2012, 39(6):  6-11. 
Abstract ( 411 )  
References | Related Articles | Metrics
Contaminants in milk are attended due to its harm to people’s health. In this paper, the maximum residue level of contaminants, detect method and system of risk monitor of contaminants in milk in different countries were presented, which might be as reference for risk monitor of milk safety in China.
Cloning and Sequence Analysis of the Inner Mongolia Cashmere Goat Keratin 5 Gene Promoter
WUDU Ba-la, A Ru-han, WU Jiang-hong, ZHANG Yan-jun, ZHANG Wen-guang, LI Jin-quan
2012, 39(6):  12-16. 
Abstract ( 450 )  
References | Related Articles | Metrics
This experiment was conducted to study the potential regulatory sequence of Keratin 5(K5). This study according to the UCSC bovine K5 gene 5' flank regions designed the PCR primers, and Inner Mongolia Cashmere goat K5 gene promoter was amplified. Analysis the K5 gene promoter sequence after product purification,ligation,transformation and sequence. It was found that 1452 bp Inner Mongolia Cashmere goat K5 promoter sequence was confirmed, which showed 91.5% and 74% homology with that of bovine and human respectively. The transcription start site was mapped to -101 bp of translation initiation site and two TATA boxes located in -129 to -124 bp (ATAAAA) and -178 to -174 bp (TTAAT) of translation initiation site respectively. The potential transcription factor binding motifs were predicted after analysis of promoter online software, including (5' to 3')SRY, MZF1, v-Myb, SRY, AP-1, CDP CR, HNF-4, AML-1a, HSF2, AP-4, AP2, AP2, Sp1, Nkx-2, Sp1 and GATA-1, in which SRY(TGTGTTT) and CDP CR(GATTGATGGC) were specific for Cashmere goat, and HNF-4, AML-1a, HSF2, AP-4, AP2, Sp1, Nkx-2 and GATA-1(AGCCATCATG) were conserved in Cashmere goat, bovine and human. Moreover, the two minimal enhancer reside from -140 to -91 bp and -114 to -67 bp of translation initiation site respectively, and contained 24 bp (GCGGCTCCCAGGTAACAGAGCCGC) overlap, which might be related with the Cashmere goat K5 gene transcriptional regulation. In this experiment, we inferred the transcription start site, transcription factor binding motifs and minimal enhancer elements in Inner Mongolia Cashmere goat K5 gene promoter, which may be helpful for exploring the mechanism of gene expression of cashmere goat K5 gene.
Construction of Avian Influenza Immune Phage Antibody Library and Establishment of an ELISA Detection Method
XING You-shang, WANG Lin, ZHANG Can, ZHAO Yin-ze, BAI Ya-duo, WU Ya-qiong, LI Yu-xin
2012, 39(6):  17-21. 
Abstract ( 417 )  
References | Related Articles | Metrics
Fab antibody of avian influenza virus subtypes was screened by phage antibody library,and an ELISA detection method was established. Mice were immunized with vaccine mixed of subtypes of AIV, the total RNA was extracted from harvested spleens, immunoglobulin light-chain and heavy-chain gene was amplificated with the template of total RNA, and cloned into phagemid pComb3, the recombinant phagemid pComb3 was transformed into XL1-Blue competent cells, after infected with helper phage VCSM13, Fab antibody library of 8?107 CFU was obtained. Specific clones anti-H5N1 virus was obtained after 4 rounds of screening,ELISA detection method was established with specific clones.
Development and Application of Semi-quantitive RT-PCR for the Main Structural Protein Genes of Porcine Reproductive and Respiratory Syndrome Virus
HUANG Juan, SHAN Hu
2012, 39(6):  22-26. 
Abstract ( 390 )  
References | Related Articles | Metrics
Three pairs of primers were designed according to the sequence of PRRSV VR2332 strain to amplify GP5、M and N protein gene respectively, a semi-quantitative RT-PCR method was developed. Different shRNA expressing vectors were cotransfected into HEK293A cells with vectors expressing structural proteins of PRRSV, and the mRNA levels of target gene were assayed by semi-quantitative RT-PCR. The results showed that the mRNA levels of structural proteins were inhibited from 36% to 69%, and pSi-N3 and pSi-G1 showed the strongest inhibition effect. It indicated that the method was suitable for relative quantitation of the main structural proteins of PRRSV.
Bioinformatics Analysis of TK Gene of Pseudorabies Virus SL Strain from Pigs
ZHANG Shi-qiang, YI Yue, XU Zhi-wen, ZHU Ling
2012, 39(6):  26-30. 
Abstract ( 721 )  
References | Related Articles | Metrics
TK gene of pseudorabies virus SL strain was cloned. Based on the sequence, the homology, phylogeny tree, codon bias, amino acid structure, hydrophilic and hydrophobicity, transmembrane region and signal peptide were analyzed. The results showed that TK gene was successfully cloned and it consisted 963 nucleotides encoding a protein of 320 amino acids. The TK gene shared over 99.3% homology with that of the other PRV strains. PRV TK was predicted to not have the transmembrane region and signal peptide, and not be inside of virus envelope.
Expression Difference of Keratin 26 Gene of Skin Tissues in Superfine and Fine Merino Sheep
TIAN Yue-zhen, DI Jiang, WU Wei-wei, TIAN Ke-chuan, HUANG Xi-xia, XU Xin-ming, HA Ni-kezi稵u La-fu, FU Xue-feng, ZHANG Yan-hua, MA Yi-la稵u Er-xun, AI Mai-ti稭ai Mai-ti
2012, 39(6):  31-37. 
Abstract ( 449 )  
References | Related Articles | Metrics
In this study, a Real-time PCR system was developed for detection of Keratin 26 (KRT26) gene expression difference of skin tissues in Superfine and fine Merino sheep using 18S rRNA,β-actin and GAPDH genes as internal control genes based on SYBR Green Ⅰ dying technique.The results showed that threshold cycle(Ct) of the standard curve displayed good linear relationship with the concentrations of standard cDNA in a certain range.Significant difference of KRT26 expression were observed in the skin tissues of different fineness of wool sheep, and the expression ratio between super-fine and fine wool was 1.5 when the 18S rRNA,β-actin and GAPDH were reference genes respectively. It might be sure the relationship with KRT26 and the wool fineness, and this might be provide a foundation for molecular breeding and improvement of the wool traits of sheep.
Construction and Application of Real-time Quantitative PCR for Detection of African Swine Fever Virus
LI Hong-li, CAO Jin-shan, WANG Jun-wei, ZHANG Wei
2012, 39(6):  37-40. 
Abstract ( 551 )  
References | Related Articles | Metrics
In order to construct real-time quantitative PCR assay for detection of African swine fever virus, this study was based on 23 isolates of gene sequence which encodes ASFV structural protein p72 in GenBank, then designing primers and probe. The reaction conditions were optimized by using different annealing temperature, different Mg2+ concentrations, different primers and probe concentrations. The real-time PCR system could automatically generate standard curve, testing repeatability, sensitivity and specificity. Wild boar samples were detected by this assay. The results showed optimal annealing temperature was 60 ℃, optimal Mg2+ concentration was 4 mmol/L, optimal primers and probe concentration were 0.8 and 0.3 μmol/L.The coefficients of variation of repeatability test were less than 1.3%, sensitivity tests could detect 10 copies/μL plasmids, the specificity was tested by detecting five others swine viruses and ASFV plasmid, only detection of ASFV plasmid appears amplification curve. In conclusion, constructed real-time quantitative PCR assay was rapid,sensitive and specific assay for detection of ASFV.
Establishment of TaqMan Real-time Quantitative PCR Method for Detection of PCV2
ZENG Si-yao, ZHANG Shu-qiong, YU Shao-hua, TANG Zhi-ling, CHEN Rui-ai, LUO Man-lin
2012, 39(6):  41-46. 
Abstract ( 568 )  
References | Related Articles | Metrics
The research with porcine circovirus type 2 (PCV2) of the ORF2 capsid protein gene for the purpose, design and synthesis of specific primers and probes. Gene was amplified by PCR and cloned into the pMD18-T vector, screened positive plasmid standards. By quantitative PCR optimization of reaction conditions, establishment of a real-time detection of PCV2 TaqMan quantitative PCR method. The results showed that the method was specificity, the pig pseudorabies virus (PRV), porcine reproductive and respiratory syndrome virus (PRRSV), swine fever virus (CSFV) and other common diseases of the original pig detection results were negative.Compared with ordinary PCR method, the sensitivity was 100 times higher, up to 100 copies/μL; for the detection of clinical samples showed that the method can effectively detect lymph nodes, lungs and other tissues of PCV2.
Immunogenicity Identification of M1 Matrix Protein of A/duck/Fujian/31/2007 H5N1 Subtype Influenza Virus Expressed in Escherichia coli
BU Ri-e, WU Jin-hua, SUN Li-jie, LI Ming-gang, LIU Yang, XUE Xiao-yang
2012, 39(6):  46-49. 
Abstract ( 430 )  
References | Related Articles | Metrics
Based on published AIV(H5N1)genome sequence, a fragment of about 750 bp long was amplified by PCR technique with specific primers using biological software DNAStar to analysis. Then the amplified product was directionally cloning into pET30a expression vector. After identifying with enzyme cut and sequencing, the recombinant plasmid was transformed into E. coli BL21(DE3). The recombinant protein M1 was expressed in inclusion body form in E coli after induction with IPTG. After denaturation, purification and renaturation, the concentration of purified protein was 0.656 mg/mL, Western blotting showed the recombinant protein had a good immunogenicity. The purified protein immunized BALB/c mice, indirect ELISA showed that the recombinant protein could produce specific antibodies anti-M1 IgG, which had a good immunogenicity. That is a better basic for diagnostic and genetically engineering vaccine research on H5N1 influenza virus.
Prokaryotic Expression and Identification of Cryptosporidium parvum Surface Antigen CP15 Gene in Escherichia coli BL21
MANDA, LAN Li, WANG Yan-xia, WANG Min, GERILETU
2012, 39(6):  50-53. 
Abstract ( 370 )  
References | Related Articles | Metrics
To construct a recombinant plasmid contain CP15 gene of Cryptosporidium parvum(C.parvum) and obtain recombinant protein. The surface antigen CP15 gene fragment of C.parvum was amplified from plasmid pMD-CP15 by PCR,and subcloned into pGEX 4T-3.The fusion express recombinant vector pGEX-CP15 was constructed in E.coli BL21. The recombinant protein was induced by 1 mmol/L IPTG and identified by SDS-PAGE and Western blotting. The CP15 gene fragment was amplified correctly as the size of gene was about 390 bp, and the recombinant plasmid pGEX-CP15 was constructed. The protein band with a molecular weight of 42 ku was detected on SDS-PAGE, which totally same with the theoretical size. The expressed protein was identified by Western blotting performed with GST serum. The fusion protein of CP15 was highly expressed in E.coli.
Cloning and Sequence Analysis of Fusion Protein Gene of Canine Distemper Virus Isolated from Guizhou
ZENG Zhi-yong, ZHOU Li, LIU Zhi-jie
2012, 39(6):  53-56. 
Abstract ( 455 )  
References | Related Articles | Metrics
Two pairs of primers were designed and synthesized based on the sequence of the Onderstepoort strain of canine distemper virus reported in GenBank, and the F gene was amplified by reverse transcription polymerase chain reaction (RT-PCR) from CDV-GZ1 strain. The amplified fragment was cloned and analyzed. The results showed that the length of CDV-GZ1 F gene was 1989 bp. It contained five potential N-glycosylation locations based on the derived amino acid sequences. The homology of coding amino acid between this strain and American 00-2601 and domestic HL strain was 91.6% and 91.1% respectively, it showed that they had common ancestor.
Cloning of EP0 Gene of Pseudorabies Virus and its Expression in E. coli
SUN Lei-lei, CHENG Yi, LIANG Zi-sen, ZHOU Hui-ying, JU Chun-mei
2012, 39(6):  57-60. 
Abstract ( 374 )  
References | Related Articles | Metrics
To study the location and function of EP0 protein in particles of pseudorabies virus, CDS region of EP0 gene was amplified by PCR, and then ligated with pMD18-T to construct a recombinant plasmid pMD-EP0.After identification by sequencing analysis, EP0 gene was extracted from this plasmid digested by EcoRⅠ and Hind Ⅲ, and cloned into pET-32a(+)vector to construct a recombinant expression plasmid pET-EP0.This plamid was identified by PCR and sequencing analysis and then transformed into E. coli BL21(DE3).The target protein was detected by SDS-PAGE and Western blotting. The result showed that CDS region of EP0 gene, a fragment containing 1227 bp was amplified successfully and EP0 protein was expressed efficiently with the size of 75 ku and existed in inclusion body. The result of Western blotting showed that the expressed EP0 protein could be combined with positive serum of PRV.
Cloning and Sequence Analysis of F Gene of a Genetype Ⅸ Newcastle Disease Virus Isolated from Duck
YUAN Yuan-hua, WANG Jun-feng, CAI Li-li, HUANG Xing-guo, LIANG Xiao-ying, CAO Wei-sheng, HUANG Shu-jian
2012, 39(6):  61-64. 
Abstract ( 467 )  
References | Related Articles | Metrics
Newcastle disease virus strain GD1002, isolated from the diseased ducks in Guangdong province in 2010, was velogenic according to the pathogenetic tests and highly pathogenicity to duck. The results of virulence determination showed that the MDT, ICPI and IVPI were 56.0 h, 1.64 and 2.29, respectively, belonged to velogenic strain virulence criterion. The F gene of GD1002 strain was amplified by reverse transcription polymerase chain reaction (RT-PCR). The cleavage motif 112R-R-Q-R-R-F117 of F protein was identical to the characteristic of velogenic strain. For genotyping, phylogenetic tree based on the nucleotide 47 to 420 nt of the F gene were performed using the isolate and other NDV sequences obtained from GenBank. The results revealed that the isolate belonged to genotype Ⅸ. And the results of nucleotide sequence homology and evolutionary processes analyses showed that the isolate had a close relationship with F48E9, JS/1/97/Ch and FJ/1/85/Ch strains.
Differential Expression of β-defensins from Mammary Gland in Holstein Cow
CHENG Lan-ling, CAO Gui-fang, WEN Shi-yong, ZHAO Peng-wei, GUAN Hong-min, JIAN Rui-zhen
2012, 39(6):  65-68. 
Abstract ( 442 )  
References | Related Articles | Metrics
The aim of the present study was to demonstrate the expression of β-defensins in the mammary glands of Holstein cows. Six kinds of β-defensins were amplified and compared the amino acid sequence. The results showed that all of them had six conserved cysteine residues. The nucleic acid sequence was compared with the NCBI database sequence, the homology result of LAP and BNBD4 were 100%, BNBD5 was 99.6%, EBD was 99.5%, BNBD7 and TAP were 98.5%. The mRNA expression of six kinds of defensins was detected by using Real-time quantitative PCR. The results showed that the relative expression of them were significant difference each other, but only the expression of BNBD4 and BNBD5 was no significant difference. The relative expression quantity of LAP was the highest, BNBD7, EBD, BNBD5, BNBD4 were middle, TAP was the lowest.
Development and Preliminary Identification of Monoclonal Antibodies against Elk Recombinant Prion Protein
ZHANG Xin-xin, LIU Yu-tian, WU Xiao-dong, LIU Huan-qi, WANG Zhi-liang
2012, 39(6):  69-71. 
Abstract ( 369 )  
References | Related Articles | Metrics
To develop the monoclonal antibody against chronic wasting disease, in this study, the PrPc-null mice were immunized with elk purified recombinant prion protein(PrPc). After twice booster immunizations, mouse spleen cells were fused with myelomas SP2/0 by lymphocyte hybridoma technique. Five hybridoma cell strains which could stably excrete specific monoclonal antibodies against elk PrPc were obtained by ELISA and three times subclone. The five hybridoma cell strains were named 5A5,3B2,6D12,5E3 and 1F5 respectively, whose ELISA titer were all more than 1∶10000. By evaluating, three strains belonged to IgG1 subset and other two were IgG2a subset. These McAbs could identify both elk recombinant PrPc and PrPc from elk healthy brain homogenate by Western blotting. This study filled the void of monoclonal antibody against CWD in China. Furthermore, the monoclonal antibodies laid a foundation for the research and detection of CWD.
Development of a Loop-mediated Isothermal Amplification Method for Rapid Detection of Capripoxvirus
HUANG He, LI Ying-guo, XIAO Jin-wen, NIE Fu-ping, WANG Yu, LIU Li
2012, 39(6):  72-75. 
Abstract ( 566 )  
References | Related Articles | Metrics
A method for detection of capripoxvirus (CaPV) through the loop-mediated isothermal amplification (LAMP) was established. The conditions for amplification of CaPV DNAs were optimized using LAMP Real Time Turbidimeter LA-320. It was found that at 62 ℃ for 60 min, highly efficient amplification of the goat pox virus(GPV), sheep pox virus(SPV)and bovine lump skin disease virus (LSDV) were achieved. The minimum detection of viral nucleic acid content was up to 3.1×10-2 pg/μL, 104 times higher than the PCR method recommended by OIE. The method was rapid, specific and easy to operate.
Epidemic of Canine Distemper Virus was Detected by RT-PCR
QIU Yun-yun, SHI Peng-fei, XIA Fei-qin, ZHANG Bao-xin, ZHAO Fan-fan, WANG Xiao-du
2012, 39(6):  76-78. 
Abstract ( 445 )  
References | Related Articles | Metrics
Canine distemper caused by canine distemper virus (CDV) is acute infection disease of canine, which caused severe losses. In this study, specific primers recognized CDV nucleoprotein were designed, the 287 bp production was amplified by RT-PCR. This production was cloned by TA cloning and sequenced, the results showed that there was a high homogeneity of 98% in nucleotide with canine distemper virus NP sequence (accession number: EU716322) published in the GenBank. Epidemic of canine distemper in Hangzhou and other cities nearby was investigated by this specific RT-PCR. The results showed that total positive detection rate of CDV was 6.7%, the number of positive individuals in Hangzhou city was largest and positive detection rate was most up to 18.8%, positive detection of other cities (Linan, Taizhou, Zhoushan) were lower. The study is basic to prevention and treatment of canine distemper.
Detection of Rabies Virus by TaqMan Probe Real-time RT-PCR
WANG Zhen-quan, LUO Bao-zheng, BO Qing-ru, ZHOU Chang-fang, BAI Ge, XU Yuan-jing, WANG Chong, WU Dian-jun
2012, 39(6):  79-82. 
Abstract ( 629 )  
References | Related Articles | Metrics
To establish the method of TaqMan probe real-time RT-PCR for detection of rabies virus, a pair of primers and probe were designed based on the nucleoprotein sequences of rabies virus that published in GenBank. RNA was extracted from rabies virus vaccine, and then amplified by RT-PCR, cloned the target fragment and took the recombination plasmid as standard positive control. The results showed that the method can distinguished rabies virus from canine distemper virus, canine parvovirus, canine adenoviruses, canine coronavirus and canine para influenza virus, the sensitivity could attained 10 copies/μL and the stability test was good.
DNA Methylation and its Biological Functions
SHEN Xiu-ping, LIN Yue-xia, XU Qi
2012, 39(6):  83-86. 
Abstract ( 518 )  
References | Related Articles | Metrics
DNA methylation is a major epigenetic modification of genome and plays crucial role in regulation of gene expression. The mechanism, mode and characteristic of DNA methylation were introduced. And the role of DNA methylation in development and differentiation, X chromosome inactivation, gemomic imprinting and heterosis were discussed.
Swine Hepatitis E Virus ORF2 Partial Gene Expression and Identification of Prokaryotic
OUYANG Yun, ZHANG Liang-quan, LIU Zhi-gang, QI Hai-tao, XU Ting-chuan, ZHANG Min-ze, ZHANG Chao-yi, ZHANG Gui-hong
2012, 39(6):  86-89. 
Abstract ( 409 )  
References | Related Articles | Metrics
The assay was aim to express swine hepatitis E virus (sHEV) ORF2 partial gene fragments, purify the expression product and analyze the antigenicity. ORF2 gene was amplified by PCR from sHEV cDNA as a template,and the recombinant plasmid pET32a-dORF2 was constructed,then transformed into the expression bacteria BL21. After IPTG induction, the protein was analyzed by SDS-PAGE and Western blotting. The results showed that the protein was expressed from ORF2 gene in the form of soluble, the protein was 60 ku. The result of Western blotting analysis indicated that the protein could react with the HEV positive serum.
PCR Amplification and Sequence Analysis of ITS rDNA of Anisakid larvae in Imported Pacific Cod
LI Xiao-jun, CHEN Yu, TANG Xing-zhong, HONG Qing-lin
2012, 39(6):  90-92. 
Abstract ( 409 )  
References | Related Articles | Metrics
The aims of this study were to amplify and analyze the sequence of internal transcribed spacers (ITS) of ribosomal DNA (rDNA)of Anisakid larvae samples isolated from frozen pacific cod imported from Japan. The DNA of the samples were extracted and the ITS sequences were amplified by PCR with primers NC5 and NC2. The products were cloned into pMD18-T vector and the inserts were successfully sequenced. The results revealed ITS inserts were 906 bp in length and consisted of partial 18S,28S and complete ITS1 (353 bp),5.8S(157 bp)and ITS2(299 bp) rDNA sequences. The similarity in ITS1 and ITS2 sequences among the Anisakid larvae sample and Pseudoterranova decipiens available in GenBank were over 99.7%,and lower homology with other nematodes.The results of the present study provided a foundation for further studies of Anisakid larvae.
Cloning and Sequence Analysis of Xinjiang Bashenbai Sheep ISG15 Gene
CUI Ru-peng, SHEN Wen, LU Hai-fu, SUN Yan-ming
2012, 39(6):  93-97. 
Abstract ( 446 )  
References | Related Articles | Metrics
In order to study the molecular construction of the ISG15 gene from Xijiang Bashibai sheep, RNA was extracted from the lymphocyte, which was isolated from the peripheral blood of the Bashibai sheep. The specific primer designed was amplified by the RT-PCR method. Then cloned the gene order of Bashibai sheep, PCR products that were reclaimed were cloned into pMD18-T vector, and then transformed into DH5α, detected masculine clone, proceeded sequence analysis. The conclusion showed that total length of the genetic coding region cloned from Bashibai sheep is 522 bp, and 172 amino acids were encoded. BLAST analysis showed that Bashibai sheep ISG15 gene shared 99%, 98%, 95%,94%,94% and 82% homology with those of Ovis aries, goat, Ovis aries breed Small Tail Han, Bubalus bubalis, bos and Sus scrofa respectively. Molecular phylogenetic tree analysis showed that Bashibai sheep assembled to Ovis aries, then assembled to Ovis aries breed small Tail Han and bos. The clustering was identical to the biological classification.
Effect of Coated Sodium Butyrate on Growth Performance and Blood Biochemical Index of Weaning Xiang pig
CHEN Guo-shun, YU Rong, FENG Guang-yu
2012, 39(6):  98-100. 
Abstract ( 488 )  
References | Related Articles | Metrics
This experiment used the single factor completely randomized experimental design, a total of 72 weaning Xiang pigs were divided into three groups randomly. Every group had 24 heads. a (control group): basal diet; b: basal diet +300 mg/kg coated sodium butyrate; c: basal diet + 500 mg/kg coated sodium butyrate. Study of compound coated sodium butyrate on weaning Xiang pig growth performance and blood biochemical index influence. The experimental result indicated that: compared with the control group, the compound coated sodium butyrate could significantly improve feed conversion rate(P<0.05), and significantly reduce weaning Xiang pig’s diarrhea rate (P<0.05).The A/G, GLB, IgG, and AKP were content along with the coated sodium butyrate showed higher increasing in the tendency. It was suggested that adding 300 mg/kg coated sodium butyrate in compound feed of Xiang pig was better than adding 500 mg/kg.
The Effect of Adding Sorbic Acid on the Fermentation Quality and Nutrient Contents of King Grass Silage
LI Mao, ZI Xue-juan, ZHOU Han-lin, HOU Guan-yu, LIU Guo-dao
2012, 39(6):  101-104. 
Abstract ( 465 )  
References | Related Articles | Metrics
The experiment was carried out to investigate the influence of adding sorbic acid on the fermentation quality and nutrient contents of King grass (Pennisetum purpureum Rich.?P.americana kinggrass cv) Silage, and to determine the proper application rate of sorbic acid. The treatments were designed as follows: control (0), 0.05%, 0.10%, 0.15%, 0.20% and 0.25% of sorbic acid addition (fresh weight basis of King grass). The results showed that decrease the pH value(P<0.05) and increased the contents of acetic acid, propionic acid and total acid were significantly (P<0.05), and added higher than 0.1% sorbic acid increased the contents of lactic acid were significantly (P<0.05) after 30 days fermentation compared with control. The contents of CP was significantly increased(P<0.05). However, there were not significant difference in DM, NDF, ADF and WSC contents(P>0.05). It could suggest that 0.15% of sorbic acid was the proper application rate.
Effects of Diets with Different Zinc Levels on Nutrient Digestibility and Metabolism, Growth Performance and Serum Biochemical Parameters in Male Minks of Growing Period
REN Er-jun, JIANG Qing-kui, YANG Fu-he, LIU Jin-jun, CHENG Jiang-peng
2012, 39(6):  104-108. 
Abstract ( 505 )  
References | Related Articles | Metrics
Zinc methionine (Zn-Met) with levels of 0 mg/kg (group Ⅰ),15 mg/kg(group Ⅱ),30 mg/kg(group Ⅲ),45 mg/kg (group Ⅳ),60 mg/kg(group Ⅴ),75 mg/kg (group Ⅵ) and Zinc sulfate with the level of 60 mg/kg (group Ⅶ),respectively,were used to evaluate the effects of different zinc levels on male minks in the growing period. The results were as follows: feed intake and protein digestibility were significantly higher than that in other groups when zinc methionine level reached 15 mg/kg (P<0.05). Dry matter digestibility, fat digestibility, nitrogen intake, urine nitrogen, nitrogen retention, net protein utilization and biological value of protein ,BUN and LDH were not significantly affected by dietary zinc levels (P>0.05).
Effect of Fructooligosaccharides(FOS), Bacillus Preparation on Growth Performance,Immune Function in Weaning Piglets
WU Wei, WANG Yi-fan, LI Xiao-cui, HU Shi-feng, BIAN Chuan-zhou
2012, 39(6):  109-112. 
Abstract ( 501 )  
References | Related Articles | Metrics
The experiment was to conducted to investigate the effects of Bacillus preparation,fructooligosaccharides on growth performance and the effects of serum immunoglobulin IgA,IgG, CD4, CD8, antibody levels in CSF.Eighty 28 d old weaning Duric譟orkshire譒andrace pigs were divided into four groups with four replicates, each of which including 5 piglets for a 28- day feeding trial. The four treatment pigs were fed basal diets, basal diets with 0.1% Bacillus, 0.4% FOS and 0.1% Bacillus+0.4% FOS inclusion respectively. The results indicated that the diet with FOS, Bacillus could significantly improve weaning daily gain, feed conversion rate and reduce diarrhea rate(P<0.05);FOS, Bacillus could significantly improve weaning classical swine fever antibody levels, serum IgA levels and serum IgG levels(P<0.05), but had little effect on CD4, CD8 indicators.
Effect of Different Processing Methods of Corn on Performance of Finishing Steers
WAN Fa-chun, WANG Wen-juan, LIU Xiao-mu, SONG En-liang, FU Ying, LIU Gui-fen, TAN Xiu-wen, CHENG Hai-jian
2012, 39(6):  113-116. 
Abstract ( 437 )  
References | Related Articles | Metrics
The objective of the study was to determine the effect of different processing methods of corn on performance and carcass characteristics of finishing steers. One hundred and twenty Limousin and Luxi crosscred steers (initial body weight=590 kg±10 kg) were randomly assigned to steam-flaked(A),crushed through 7 mesh sieve(B), crushed through 10 mesh sieve(C) and crushed through 14 mesh sieve(D) corn diets. To study the effect of different processing methods of corn on performance of finishing steers.The results showed that diets had no effect on body weight, daily gain, feed conversion efficiency, carcass weight, dressing percentage, net beef percentage, ratio of bone to meat, eye beef weight, marble score, thickness of back fat, and eye muscle area(P>0.05).The steers that received A diet had the higher percentage of total carcass products and the lower bone weight than those on C(P<0.05).The higher high-grade beef percentage and rib eye weight ,and the lowest tenderloin weight were recorded in steers fed with D diets compared to those that received A ,B and C diets(P<0.05). The steers that received B diet had the higher sirloin than those on C(P<0.05). The economic effectiveness was the best of steers fed with C diets compared to those that received A, B and C diets.
Evaluation of Different Dietary Protein Levels on Preparative Mating Minks
JIANG Qing-kui, ZHANG Zhi-qiang, LI Guang-yu, GAO Xiu-hua, XING Xiu-mei, YANG Fu-he
2012, 39(6):  117-120. 
Abstract ( 460 )  
References | Related Articles | Metrics
The experiment was conducted to evaluate the regularity of digestibility and metabolism of diets with different levels in female minks on preparative mating period. 180 healthy female minks of one year and a half old were randomly assigned into six groups with 30 replicates and each replicate had 1 mink. The treatments were individually fed with 28.59%(group Ⅰ),32.31%(group Ⅱ),36.21%(group Ⅲ),40.35%(group Ⅳ) protein levels in fresh feed diets and with 32.66%(group Ⅴ),40.47%(group Ⅵ) protein levels in mixed feed diets. The period of trial lasted for 51 days,including 7 days preset period and 44 days test period. The results showed that the food intake of the fresh feed diets groups was higher than that of the mixed feed diets group,some had significantly difference(P<0.05). On the item of the digestibility of dry mater,protein and fat,some had significantly difference (P<0.05).The nitrogen intake, fecal nitrogen, urine nitrogen increased with the protein level in different groups. There was no significantly difference in nitrogen retention, the biology value of protein, net protein usage ratio. However, all of the three indexes tended to decrease when the dietary protein level reached 36.21%. Of all the indexes, the mixed feed diets group were significantly or extremely lower than the fresh feed diets group(P<0.05 or P<0.01). In conclusion, the minks had almost equally best nutrient digestibility and availability when the dietary protein level reached 32.31% and 36.21%, but in consideration of the feed expense and the particular characteristics of the preparative mating minks, 32.31% protein level of diet would be the best choice in the preparative mating period, and the mixed feed diets were not recommended for this particular period.
Effects of Dietary Acid Detergent Fibre Levels on Sperm Quality, Serum Biochemical Parameters and Generative Hormones in Adult New Zealand Breeder Male Rabbits
CHU Han-ping
2012, 39(6):  121-124. 
Abstract ( 396 )  
References | Related Articles | Metrics
The experiment was conducted to study the effects of dietary acid detergent fibre(ADF) levels on sperm quality, serum biochemical parameters and generative hormones in adult New Zealand breeder male rabbits. Eighty 2-years-old breeder male rabbits were randomly assigned to 4 groups with 20 replicates in each group and 1 rabbit in each replicate. Rabbits in the 4 groups were fed with 4 ADF levels(13%,16%,19%,22%) respectively. The results were listed below: Dietary ADF levels had significant influence on the sperm quality(P<0.05),the sperm volume of group 3 were significantly higher than those of group 1 and group 2(P<0.05),the sperm concentration of group 3 and group 4 were significantly higher than those of group 1 and group 2(P<0.05), the sperm motility of group 3 were significantly higher than those of the other groups(P<0.05).Dietary ADF levels had significant influence on the serum biochemical parameters(P<0.05), the contents of total protein (TP) of group 2 and group 3 were significantly higher than that of group 1(P<0.05), the cholesterol(CHO) of group 1 were significantly higher than those of the other groups(P<0.05). Dietary ADF levels had significant influence on the serum generative hormones(P<0.05), the LH, T and E2 of group 2 were significantly higher than those of the other groups(P<0.05),the FSH of group 2 were significantly higher than that of group 1 and group 4(P<0.05). In conclusion, the appropriate dietary level of ADF for the 2-years-old breeder male rabbits was 16% to 19%, even 22%.
Research Progress of Taurine in Fish Nutritiona
DONG Xiao-qing, ZHANG Dong-ming, GE Chen-xia
2012, 39(6):  125-127. 
Abstract ( 623 )  
References | Related Articles | Metrics
The text introduced the distribution, synthetic ways, biological function, application in fish nutrition and research progress of taurine. For further research taurine as fish feed additives provide the help.
Advances in JAK-STAT Signaling Pathway
SONG Zhou, ZHANG Li-yan, DONG Hai-bing, BAI Huan-li, CHEN Wei, WU Shuai-cheng, YI Peng-fei, FU Ben-dong, SHEN Hai-qing, WEI Xu-bin
2012, 39(6):  128-132. 
Abstract ( 528 )  
References | Related Articles | Metrics
JAK-STAT signaling pathway involved in various of physiological and pathological responses. JAK kinases were activated after the binding of cytokines to their corresponding receptors, further phosphorylation of STATs were produced which result in homologous or heterologous dimerization, the dimeric protein then translocated into the nucleus and binding the promoters of relevant target genes for the controlling of expression of objective proteins. Consequently, the pathway plays an momentous role in the regulationg of organisms.
Identification and Culture of Neural Stem Cells Isolated from Postnatal Wistar Rat Hippocampus
CHEN Ke-yan, WANG Cheng-li, ZHANG He, AN Yang, SU Peng, SUN Qian, WANG Yang
2012, 39(6):  132-136. 
Abstract ( 422 )  
References | Related Articles | Metrics
To establish a method to isolate culture and identify the neural cells from postnatal Wistar rat hippocampus. The neural stem cells were isolated from postnatal 24 h Wistar rat hippocampus and cultured with DMEM containing 20% fetal bovine serum /F12 medium, and observation in inverted phase contrast microscope daily. The results showed that the neural stem cells isolated from postnatal Wistar rat hippocampus had reproductive activity and the exponential growth phase of neural stem cells was 2 to 8 d and maintain 30 d. The cells were identified by immunofluorescence expression of Nestin positive, and immunohistochemistry results showed that the cell bodies in the subculture and processes were NF-positive markers, GFAP antibody and CD68 antibody color were negative. Thus, the cells isolated and cultured from postnatal rat hippocampus had shown a strong ability of self-renewal proliferation and multipotency of differentiation which were evidently identified as the neural stem cells.
Research Progress of Long Chain Acyl-CoA Synthetase
LI Qing-gang, TAO Zhu, YANG Yu-zeng, ZHANG Bo, SHI Li-hua, BAN Dong-mei, ZHANG Hao
2012, 39(6):  137-140. 
Abstract ( 1260 )  
References | Related Articles | Metrics
Long chain acyl-CoA synthetases (ACSLs) are encoded by a multi-gene family. Synthesis of acyl-CoA catalyzed by acyl-CoA synthetase (ACS) is the first step in mammalian response to the use of fatty acids,so ACSL in fat metabolism plays a major role. In this review,we cover the nomenclature and classing of the ACSL family,the expression of ACSL gene influencing on fat metabolism,the selectivity of different ACSL family on substrate,the regulation of ACSL gene expression by different transcription factors,and the current research related to livestock ACSL. We also put forward the future research focus and research significance about the ACSL family.
Research Progress on Galectin-1 and its Biological Functions
QIN Xin-xin, SUN Hong-mei, ZHAO Hai-ping, CHU Wen-hui, WANG Da-tao, LI Chun-yi
2012, 39(6):  141-145. 
Abstract ( 472 )  
References | Related Articles | Metrics
Galectin-1,a molecular that has 14 ku,is one of the lectin family members. Being used as a diagnostic index of various cancers,Galectin-1 molecule has aroused wide interest as a new target molecule for the treatment of cancer. Besides,Galectin-1 plays various normal biological functions,such as cell growth,nerve repair,revascularization and cartilage formation. To data,little research has been done about Galectin-1 in the regeneration of deer antlers,although Galectin-1 may be indispensible in the processes during antler regeneration based on its unique function. Compared to tumour,antlers also grow fast and highly express Galectin-1,but antler tissue does not become cancerous,which could inspire us for cancer research. To develop a new cancer therapy and solve the mystery of deer antler regeneration,it is important to learn about the biological functions of Galectin-1 in both tumourogenesis and antler regeneration.
Histological Observation of Canine Ovary in Different Reproductive Stage
ZHAO Peng, LI Ji-peng, LIU Dan-yang, YIN Xi-jun, CUI Cheng-du 
2012, 39(6):  146-149. 
Abstract ( 517 )  
References | Related Articles | Metrics
In this study,the appearance and tissue structure of canine ovary in different reproductive stage were observed. The results showed that: the volume of canine ovary from follicular stage,corpus luteum stage and anestrus stage were 812.63 mm3,1081.80 mm3 and 446.03 mm3,corpus luteum stage was significant higher than follicular stage and anestrus stage (P<0.05),follicular stage was significant higher than anestrus stage (P<0.05). The weight of canine ovary from follicular stage,corpus luteum stage and anestrus stage were 0.89 g,1.14 g and 0.71 g,follicular stage was lower than corpus luteum stage,and was higher than anestrus stage,there was no significant difference(P>0.05). In the follicular stage ovary,a great quantity of secondary follicles and a small quantity of mature follicles were seen. In the corpus luteum stage ovary,a small quantity of secondary follicles and atretic follicles were seen,and there were a great quantity of corpus luteums. In the anestrus stage ovary,the main category of follicles were primordial follicle. As above mentioned,the appearance and tissue structure of canine ovary were concerned with reproductive stage.
Association of Polymorphism in MC1R Gene at Site 248 with Chestnut Coat Color in Three Chinese Horse Breeds
DANG Zhen, WANG Jia-fu, ZHAO Xing-yan, HUANG Yong, TIAN Song-jun, WANG Rong-ming, RAN Xue-qin
2012, 39(6):  149-152. 
Abstract ( 444 )  
References | Related Articles | Metrics
A single nucleotide polymorphism (SNP) at site 248 of melanocortin receptor 1 gene (MC1R) is known from European horse breeds, in which the homozygous genotype (ee) is related with the chestnut coat color of European horse individuals. To confirm the polymorphism of site 248 of MC1R gene in Chinese horse, three horse breeds of Guizhou pony, Southwest horse and Ili horse were chosen as samples with coat color of three monochromatic (chestnut, black, bay) and three kinds of complex coat color. Two pairs specific primers were designed. Two fragments, 124 and 481 bp, were amplificated by allele-specific polymerase chain reaction (AS-PCR) method. The polymorphism of site 248 in MC1R gene was further approved by cloning and sequencing of the DNA fragments. The results showed that genotypes of all samples with coat color of chestnut were heterozygous genotype (Ee). However, the genotypes of other samples were Ee either, in which the coat colors included bay, black, grey, spotted but not chestnut. It suggested that the SNP at site 248 of MC1R gene might be unrelated with the chestnut coat color in native Chinese horse breeds.
Canonical Correlation Analysis of Body Size,Growth Character and Carcass Performance in Luxi Cockfighting
QIN Qiao-mei
2012, 39(6):  153-156. 
Abstract ( 363 )  
References | Related Articles | Metrics
Fourteen variants of three sets of traits including body size traits,growth traits and carcass traits were measured and analyzed using canonical correlation analysis in Luxi cockfighting. The results showed that correlation coefficients were 0.682 to 0.767 between body size index (chest depth, chest width, shank length, bias length, chest bone length), 0.306 to 0.935 between growth traits(birth weight, 180 day weight, daily gain), and 0.945 to 0.986 between carcass performance (carcass weight, slaughter rate, semi-eviscerated weight, semi-eviscerated rate, and eviscerated weight, eviscerated rate) which were highly relevant. The results showed that the first canonical correlation were obtained between growth traits and body size traits(0.705), growth traits and carcass traits(0.560), body size traits and carcass traits (0.878). They accounted for 0.979,0.984 and 0.820 of total correlation,respectively.
Pharmacokinetics of the Pour-on Preparation of Doramectin in Dogs
LI Hai-qin, CHEN Yun, ZHU Hua-jun, YAN Cheng, YUAN Xiao-qi, JIA Xue-xia, TANG Zhao-xin
2012, 39(6):  156-160. 
Abstract ( 442 )  
References | Related Articles | Metrics
Pharmacokinetics studies of pour-on of doramectin in dog blood plasma. Drow blood from the jugular vein of the dogs in different time after used the pour-on of doramectin one time on the skin of back with the concentration 0.1 mg/kg·bw. We used the method of the HPLC to detect the concentration of the doramectin in the blood plasma. The blood plasma doramectin concentration and time data was processed by the non compartment analysis of the WinNonlin5.2.1 software. The main pharmacokinetic parameters were the maximum concentration (Cmax) of the doramectin in the blood plasma is (24.38±4.82) ng/mL, and the time is (1.00±0.00) d (Tmax)after we used the doramectin pour-on. The elimination half life (t1/2β) is (2.14±0.56) d. Area under curve (AUC) is (89.79±16.90) ng/(d·mL). The results showed that doramectin has a long persistence in the plasma concentrations and eliminated slowly in dogs.
Development of Regulation Factor of Type Ⅲ Secretion Systems in Enterohaemorrhagic Escherichia coli
WEI Bo, LIU Ming-qiang, HUHE Baterer
2012, 39(6):  161-164. 
Abstract ( 408 )  
References | Related Articles | Metrics
Type Ⅲ secretion systems (T3SS) enable the injection of bacterial proteins through membrane barriers into host cells. This system is required for colonization of their ruminant reservoir hosts by enterohaemorrhagic Escherichia coli (EHEC) and might also be important for the etiology of disease in the incidental human host. T3SS of E. coli inject a cocktail of proteins into epithelial cells that enable bacterial attachment and promotes longer-term colonization in the animal. Here, we review recent progress in our understanding of the regulation of T3SS in EHEC, focusing on the induction and assembly of the T3SS, and the co-ordination of effector protein expression.
Isolation, Identification and Drug Resistance Analysis of a Pathogenic Enterococcus Strain Isolated from Chicken
WANG Tao, DU Dong-dong, ZHUANG Yan-fei, CHANG Wei-shan
2012, 39(6):  165-168. 
Abstract ( 414 )  
References | Related Articles | Metrics
This experiment was aimed at identifying a Broad-spectrum antibiotic resistant bacteria separated from chickens and discussing the mechanism of antibiotic resistance of the bacteria from the viewpoint of molecular biology. Identify the training characteristics and biochemical experiments of the bacteria based on the standard of Common Bacteria System Identification Manual. A pair of 16S rDNA general primer was designed to amplify 16S rDNA and sequenced. 12 pairs of primer amplify resistance gene was designed based on the results of sensitive method of antibiotic test. The results of training characteristics and biochemical experiments of the bacteria showed that they were Enterococcus. A target set of 1465 bp was amplified by PCR. Sensitivity tests showed that the bacteria tolerate several antibiotics. The results of PCR showed that there exist ant(6)-iv, OXA-10, tetM, CTX-M-1, TEM gene, so it was Enterococcus. The existence of resistance gene was one of the reasons why the bacteria generate resistance characteristics.
Progress on Detection Methods of Streptococcus suis
XIA Xiao-jing, SHEN Zhi-qiang, JIANG Shi-jin, LI Shu-guang, WANG Jin-liang
2012, 39(6):  169-172. 
Abstract ( 529 )  
References | Related Articles | Metrics
Streptococcus suis is one of the most important zoonotic pathogens, establishing a series of rapid and specific detection methods plays an important role in epidemiology and clinical application research. This paper discussed the progress of immunological detection technology and molecular biological detection method on Streptococcus suis, and puts forward to the prospects for it.
Study and Application the Hyperimmunized Yolk Antibodies of TGEV and PEDV in Piglets
CUI Huan-zhong, JIANG Hai-long, ZHANG Jia-li, ZHANG Hui, QIN Gui-xin
2012, 39(6):  173-175. 
Abstract ( 566 )  
References | Related Articles | Metrics
The hyperimmunized yolk antibodies against porcine transmissible gastroenteritis virus (TGEV) and poricine epidemic diarrhoea virus (PEDV) was obtained, and its cure effect was tested. The hens were immunized with the two combined inactivated vaccine of TGEV and PEDV. After the antibody titer reached to 1∶64 tested by double diffusion and eggs of hyperimmunity were collected. The hyperimmunized yolk antibodies were purified by chloroform extraction and salt precipitation with ammonium sulfate. Microorganism detection, safe experiment, artificially infected piglets with the antigen and clinical treatment test were conducted to evaluate the application effect. The cure rate of artificial infection was 100% and the cure rate of clinic treatment test was 88.0%. The antibody had obvious curative effect against TGEV and PEDV.
Isolation and Identification of Staphylococcus aureus from Rabbit
WANG Hua, WEI Chun-hua, ZHOU Xiao-qiong
2012, 39(6):  176-177. 
Abstract ( 493 )  
References | Related Articles | Metrics
Three Grame-positive coccis were isolated from illness rabbit on a farm in Fujian province. Indentification of the isolated strains was conducted by detecting 16S rRNA,biochemical reaction,drug sensitivity.These results showed these clinical isolates were Staphylococcus aureus.
The Diagnosis of Sheep Pox
ZHANG Jian-yun, REN Ni, LI You-wen
2012, 39(6):  178-181. 
Abstract ( 520 )  
References | Related Articles | Metrics
Sheep pox is caused by the sheep pox virus disease, characterized by fever, body skin smallpox, gut mucosal nodules (especially lung).Sheep pox is one of the most serious infectious diseases that against sheep industry.It often results in infection or death of large numbers of sheep, the mortality up to 50%(100% lamb). Thus, the disease to the sheep industry is not only a huge economic losses, but also a serious impediment to the sheep industry to increase production. This paper is aimed at some sheep households in some district of Xinjiang, where a outbreak of sheep pox occurred in January 2011, we have made epidemiological investigation,clinical symptoms,pathological changes observed and laboratory diagnosis and confirmed it was caused by sheep pox.
Real-Time Quantitative RT-PCR Assay for Detection of Swine Influenza Virus
ZHANG Tai-xiang, LING Zong-shuai, YUE Zhi-qin, XU Biao, LIANG Cheng-zhu, LIU Wen-peng, ZHANG Huan-hai, ZHANG Yi-bing
2012, 39(6):  181-184. 
Abstract ( 545 )  
References | Related Articles | Metrics
A real-time quantitative RT-PCR assay was developed for detection of Swine influenza virus (SIV).Primers and probe were designed based on NP gene of SIV by Primer Express 2.0 software. The plasmid containing the target sequence was constructed to detect the sensitivity and prepare the standard curve. The real-time RT-PCR assay had a detection limit of 20 copies, with a dynamic range of detection between 2×108 to 2×102 copies/μL. The standard curve was prepared based on the linear relationship between the amount of plasmid RNA and cycle threshold (Ct).The method is specific for SIV, which failed to react with the classical swine fever virus, pseudorabies virus, foot and mouth disease virus and porcine reproductive and respiratory syndrome virus nucleic acid.The real-time RT-PCR assay that described with high sensitivity, specificity and accuracy is considered to be a powerful tool for the rapid detection and quantification of SIV.
Recent Advances in Anisakis simplex Allergy
LI Xiao-jun, GENG Xin-hui, CHEN Yu, TANG Xing-zhong, HONG Qing-lin
2012, 39(6):  185-188. 
Abstract ( 386 )  
References | Related Articles | Metrics
Anisakis simplex is a worldwide-distributed nematode that infects consumers of raw or under-cooked fish. The clinical signs of anisakiasis depend on the place in the digestive tract where the larva is deposited. Symptoms develop as a result of an inflammatory condition occurring in the gastric wall mucosa when the larva enters it. This paper deals with the recent advances in Anisakis simplex allergy which contains prevalence,clinical issues and diganoses,antigen and allergens,bases for prevention and conclusions.
Isolation and Identification of an Isolate of Bacillus licheniformis and Preliminary Study on the Effects of its Probiotics
HAN Ting-Yi, DIAO Fu-Hua
2012, 39(6):  189-191. 
Abstract ( 411 )  
References | Related Articles | Metrics
An isolate of Bacillus licheniformis was isolated from intestine of health AA broiler, and identified by colonial morphology, culture characteristic, biochemistry reaction, 16S rRNA sequencing analysis, study on the security of the isolate and its effect on immune organs of chickens. The results showed that the isolate was Bacillus licheniformis, named BL-C. The isolate had no pathogenicity on AA chickens, and could significantly accelerate its growth, promoting the development of immune organs of chicks. The study provided theoretical basis for its further application in animal breeding.
Immunization Program of Newcastle Disease, Infectious Bronchitis and Avian Influenza(H9 Subtype)Vaccine, Inactivated (Strain La Sota +Strain M41 +Strain SS/94)
LIN Qi-ping, CHEN Rui-ai, HUANG Wen-ke, YAN Jie-zhen
2012, 39(6):  192-196. 
Abstract ( 515 )  
References | Related Articles | Metrics
To study the protective efficacy and the optimal immunization procedure of Newcastle disease, infectious bronchitis and avian influenza (H9 subtype) vaccine, inactivated Strain La Sota +Strain M41 +Strain SS/94 in the broiler of yellow feather chickens, the triple vaccine immunized yellow feather chickens by different immunization procedure. Results showed that the vaccinated chickens have the similar antibody variation to ND, IB and H9. The antibody titers were low when the triple inactivated vaccine were injected only once at 10 day-old. After the secondary and third immunization at the 20 or 40 day-old, or 10-day-old first with Newcastle disease virus (La Sota strain) and avian influenza virus (H9 subtype, SS/94 strain) vaccine, inactivated for primary immunization and then strengthened the immune with the triple inactivated vaccine at the 20 or 40 day-old, the antibody titers quickly ascended and maintained a long time. According to the results, proposed that on the basis of the normal immunization procedure, it may inject the triple inactivated vaccine at 20 day-old with 0.3 mL per chicken for short feeding period chickens and at 40 day-old with 0.5 mL per chicken for long feeding period chickens.
Ultrastructure Study of Swine Infected with Shanxi Variant Strain of Porcine Reproductive and Respiratory Syndrome Virus
MENG Fan, YAO Jing-ming, WU Xin, HAN Yi-chao, FAN Zhen-hua, FAN Rui-wen, WANG Juan-ping, HOU Yan-ping, LIU Wen-jun, MI Rui-juan
2012, 39(6):  196-199. 
Abstract ( 360 )  
References | Related Articles | Metrics
The ultra microstructure of lung, spleen, liver,lymph node and other tissues from pigs infected with Shanxi variant strain of PRRSV were observed by transmission electron microscopy (TEm). Results showed that the pulmonary macrophages, the hepatocytes and the lymphocytes in the lymph nodes and the spleen were infected to different degrees, where the membranous structures of organelles was generally damaged, furthermore, the damage of mitochondria and cell nucleus was especially serious. The study shed light on pathogenesis of the disease.
Efficacy of Ten Chinese Herbal Medicine against H1N1 Swine Influenza Virus in Vitro
XU Zhen-na, WANG Bing-yun, JI Hui-qin, CHEN Zhi-sheng, CHEN Sheng-feng, YANG Hong, HE Yong-ming, CHEN Jin-ding
2012, 39(6):  200-204. 
Abstract ( 395 )  
References | Related Articles | Metrics
To observe the efficacy of ten Chinese herbal medicine against swine influenza virus, cinnamomi ramulus etc ten Chinese herbal medicine were investigated the antiviral action by chicken embryo culture and hemagglutination test in three ways to add medicine. Then, the Chinese herbal medicine that had predominance efficacy was selected to determine their therapeutic index (TI) and 50% effective dose (ED50). The results showed that: cinnamomi ramulus and herbal ephedrae have most predominance efficacy against swine influenza virus.
A Case Diagnosis of Co-infection of Porcine Parvovirus, Porcine Circovirus Type 2 and Porcine Reproductive and Respiratory Syndrome Virus
LIU Zhi-jie, ZHOU Li, ZENG Zhi-yong, LI Ru-ju
2012, 39(6):  204-206. 
Abstract ( 394 )  
References | Related Articles | Metrics
The multiple PCR method was applied for the rapid detection of viral disease from a pig farm in Qingzhen of Guizhou province. The results showed there was a co-infection of PPV,PCV2 and PRRSV of the sick pig.
Isolation and Identification of One Strain Infectious Bursal Disease Virus
ZHAO Yun-ying, ZHANG Yan-xin, ZHANG Wen-sheng, LI Fu-gui
2012, 39(6):  207-211. 
Abstract ( 400 )  
References | Related Articles | Metrics
One isolate of infectious bursal disease virus (IBDV),was isolated from the vaccination failure chicken. Through serologic AGP experiment,results showed obvious white precipitation line; the high variable (hv) region of VP2 genes were amplified by RT-PCR (reverse transcriptase polymerase chain reaction) and were compared for their sequences. It was indicated that the homology of TJ-hg strain and very virulent IBDV strain all reached above 90% and 98.8% to 99.3% at nucleotide level,respectively. And the change of amino acid was complement in high variable (hv) region of VP2 genes. The mutations amino acid Q219P located in the first hydrophilic region of TJ-hg strain. The research demonstrated that TJ-hg strain belonged to vvIBDV,but it was different from standard strain.
Isolation and Identification of Porcine Teschovirus
WANG Mei-jun, GONG Xiao-wen, ZHANG Zhi-bang, NI Jiao, JIAO Lian-guo, ZHAO Ya-rong
2012, 39(6):  212-214. 
Abstract ( 477 )  
References | Related Articles | Metrics
Some pig groups doubtfullyy infected on porcine teschovirus (PTV) in Beijing area. In order to diagnose this virus's infection, isolated the virus from the brain organization sample, and withdrawed total RNA from the separation virus, according to reported sequence. After using RT-PCR, obtained the part code primary structure protein VP1 gene and highly conservative 5'UTR area gene order, cloned these genes to the pEASY-Blunt vector. The result indicated that the isolated virus and the porcine teschovirus homology is 95% to 100% after compared with GenBank on virus sequence. This experiment successfully isolated a porcine teschovirus by naming as 10BJ02 in Beijing area.
Isolation and Identification of Pathogenic Bacteria from Suppurative Endometritis in Two Cases of Canine and Drug Sensitivity Test
HE Hai-jian, XU Li-chang
2012, 39(6):  215-217. 
Abstract ( 483 )  
References | Related Articles | Metrics
Pathogens were studied in two cases of canine septic endometritis. With the vaginal sampling method to culture secretions of bacterial and biochemical identification, the results showed that the first cases had not been separated bacteria due to continuous use of antibiotics, and the second cases of isolated Staphylococci and Streptococci. Drug sensitivity test showed that great drug resistance has been given occasion to pathogen on canine endometritis because of too much penicillin and streptomycin clinical using, while it’s still sensitive to cefazolin, enrofloxacin and ciprofloxacin. They became the first selection of clinical medicine.
Study on the Relationship between the Polymorphism of BMPR-IB Gene and Litter Size in Xinjiang Cele Black Sheep
SHAO Yong-gang, Mirinisahan Kuerban, LIU Wu-jun
2012, 39(6):  221-223. 
Abstract ( 442 )  
References | Related Articles | Metrics
The polymorphism of BMPR-IB gene which was one of the candidate genes on the fecundity of Cele black sheep was analyzed by PCR-RFLP method. The relationship between the polymorphism of BMPR-IB gene and litter size was studied. The average litter size of BB,B+ and ++ were 3.00, 2.66 and 1.98 respectively in 100 Cele black sheep which were selected randomly. The litter size of BB and B+ were significantly higher more than ++ (P<0.01), but there was no significant difference between BB and B+(P>0.05). These results indicated that the litter size of Cele black sheep was affected by B allele significantly and it could be used for the selection in Cele black sheep as one of the molecular genetic markers.
The Post-receptor Signal Transduction Mechanism of the Expression of GTH
Wang Xin
2012, 39(6):  224-227. 
Abstract ( 436 )  
References | Related Articles | Metrics
It is an important area of research on the mechanism of gonadotropin-releasing hormone. The paper reviews the domestic and foreign advances on GnRH and think GnRH regulates the synthesis and secretion of FSH and LH after binding its receptor in a series of signal transduction. The GnRH post-receptor signal transduction pathway may consist of three major signal transduction system: the cAMP signal transduction system, PKC signal transduction system and MAPK signal transduction system. cAMP signal transduction pathway and PKC signal transduction pathway belong to G protein coupling signaling pathways, who both finish regulation by activating MAPK signal transduction system at last. It provides the base on the further study, some suggestions gived on existents problems and further research direction raised.
Anesthetic Management in Bama Minipigs with da Vinci Robotic Operating System
WANG Yang, CHEN Ke-yan, ZHANG He, SU Peng, SUN Qian, WANG Cheng-li
2012, 39(6):  227-230. 
Abstract ( 427 )  
References | Related Articles | Metrics
To investigate the Bama minipigs anesthesia management strategies in the da Vinci robotic operating system. The Bama minipigs were general anaesthesia with propofol as induction of anaesthesia combined isoflurane as maintain anesthesia, and then the Bama minipigs were minimally invasive surgery of the heart, lungs, liver and stomach by the da Vinci robotic operating system, in the preoperative, intraoperative and postoperative monitoring of the Bama minipigs arterial blood gas and hemodynamic changes. The results of the experiment pigs were the successful completion of the surgery, the mean operative time (166?34) min, anesthesia time (181?38) min, pneumothorax (pneumoperitoneum) time (122?33) min, and the entire anesthesia process and in the awakening process safe and stable group of pigs, performance did not appear to body movement. Thus, the anesthetic method could be used for the da Vinci robotic operating system, and human medical clinical application in anesthesia management foundation.
The Efficacy of the Live Attenuated Bovine Viral Diarrhea Virus SM Vaccine Strain
ZHANG Shu-qin, GUO Li, WANG Wei, ZHANG Ting-ting, WU Yong-wang, WU Hua
2012, 39(6):  231-234. 
Abstract ( 449 )  
References | Related Articles | Metrics
The study was designed to evaluate neutralizing (SN) antibodies against bovine viral diarrhea virus (BVDV) in the calves vaccinated with the live attenuated bovine viral diarrhea virus SM vaccine. A total of 30 healthy calves at weaning were randomly divided into two groups, with 15 calves in vaccinate group and 15 in control group. The attenuated BVDV SM vaccine strain was administrated via intramuscular injection on the neck at a single dose and challenged with a virulent BVDV-JL virus by nasal spray. The blood samples were collected at different time points for monitoring SN antibody titers. The results indicated that the SN antibody titers in the vaccinated calves maintained at a relative high level until 12 month post-vaccination, and the vaccinated calves were effectively protected from the challenge, as detected by the white blood cell count (WBC) and virus shedding. Therefore, the duration of immunity of the vaccine was at lease for 9 months.
Taking Physical Cooling Measures to Protect Dairy Cows from Heat Stress
ZHANG Fan-jian, GUAN Wen-yi, YUE Yuan, HOU Yin-xu, WANG Jiu-feng
2012, 39(6):  236-239. 
Abstract ( 463 )  
References | Related Articles | Metrics
Heat stress has become the major challenge for global dairy cow industries. Countries are all actively mobilizing the strength of scientific research and technology to solve the global problems, and have made some progress. At the same time, dairy farms also have work out successful experience through repeatedly practice. Physical cooling measures are currently considered to be the most effective measures to relieve the effects of cow heat stress. This article discusses about heat stress of dairy cow and the principle and use of physical cooling measures from cow health perspective, in order to choose the most appropriate measures.
Manganese Effects on the Reproductive Performance of Livestock and Poultry Progress
CAO Yang, CONG Yu-yan
2012, 39(6):  239-242. 
Abstract ( 433 )  
References | Related Articles | Metrics
The trace element manganese is a necessary material that maintains metabolism and normal growth and development of animals. Manganese on the reproductive performance of the maintenance of livestock and poultry plays an important role. In this paper, manganese effects on animal reproductive performance was reviewed to summarize the results of previous studies, the basis for further study.
Investigation on Highly Pathogenic Porcine Reproductive and Respiratory Syndrome
LUAN Zhi-hua, ZHOU Hong-chen
2012, 39(6):  242-244. 
Abstract ( 421 )  
References | Related Articles | Metrics
To investigate the infection status and the immune effect of the highly pathogenic porcine reproductive and respiratory syndrome (HP-PRRS) from immunized pig populations of Panjin city in 2011, 2160 serum samples and 120 tissue specimens were collected from pig farms in Panjin city from January to December in 2011, and examined by enzyme linked immunosorbent assay (ELISA) and quantitative real-time PCR respectively. The results showed that there were not the highly pathogenic porcine reproductive and respiratory syndrome virus (HP-RRSV) in the tissues, the antibodies positive rate in Dawa,Panshan, Xinglongtai,Shuangtaizi was 82.2%, 81.1%,78.8%,81.1%, respectively; the antibodies positive rate in swine breeding farm,commercial pig farm,peasant household pigs was 90%,81.3%,75%, respectively. In summary, the immune status of HP-PRRS was fine, HP-PRRS did not break out in this year.
Progress on Research of Host Resistance-relevant Genes to Pathogen Infection
CHENG Gang, WANG Jing-ren, LI Shu-hong, WANG Xing-ping
2012, 39(6):  245-248. 
Abstract ( 512 )  
References | Related Articles | Metrics
Genetic factors strongly determine the difference of susceptibility and resistance to pathogen infection between animals. Uncovering the complex genetic basis of this natural mechanism,clone and identify host resistance-relevant genes is requested;study the mechanism from gene level is needed,thus we can prevent and control diseases efficiently. We review the meaning,method,category,distribution,molecular basis and prospect of host resistance-relevant genes to pathogen infection respectively.