-
Cloning and Sequence Analysis of the Inner Mongolia Cashmere Goat Keratin 5 Gene Promoter
- WUDU Ba-la, A Ru-han, WU Jiang-hong, ZHANG Yan-jun, ZHANG Wen-guang, LI Jin-quan
-
2012, 39(6):
12-16.
-
Abstract
(
456 )
-
References |
Related Articles |
Metrics
This experiment was conducted to study the potential regulatory sequence of Keratin 5(K5). This study according to the UCSC bovine K5 gene 5' flank regions designed the PCR primers, and Inner Mongolia Cashmere goat K5 gene promoter was amplified. Analysis the K5 gene promoter sequence after product purification,ligation,transformation and sequence. It was found that 1452 bp Inner Mongolia Cashmere goat K5 promoter sequence was confirmed, which showed 91.5% and 74% homology with that of bovine and human respectively. The transcription start site was mapped to -101 bp of translation initiation site and two TATA boxes located in -129 to -124 bp (ATAAAA) and -178 to -174 bp (TTAAT) of translation initiation site respectively. The potential transcription factor binding motifs were predicted after analysis of promoter online software, including (5' to 3')SRY, MZF1, v-Myb, SRY, AP-1, CDP CR, HNF-4, AML-1a, HSF2, AP-4, AP2, AP2, Sp1, Nkx-2, Sp1 and GATA-1, in which SRY(TGTGTTT) and CDP CR(GATTGATGGC) were specific for Cashmere goat, and HNF-4, AML-1a, HSF2, AP-4, AP2, Sp1, Nkx-2 and GATA-1(AGCCATCATG) were conserved in Cashmere goat, bovine and human. Moreover, the two minimal enhancer reside from -140 to -91 bp and -114 to -67 bp of translation initiation site respectively, and contained 24 bp (GCGGCTCCCAGGTAACAGAGCCGC) overlap, which might be related with the Cashmere goat K5 gene transcriptional regulation. In this experiment, we inferred the transcription start site, transcription factor binding motifs and minimal enhancer elements in Inner Mongolia Cashmere goat K5 gene promoter, which may be helpful for exploring the mechanism of gene expression of cashmere goat K5 gene.